PCK2 (NM_001018073) Human 3' UTR Clone

CAT#: SC203466

3`UTR clone of phosphoenolpyruvate carboxykinase 2 (mitochondrial) (PCK2) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PCK2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PCK2
Synonyms PEPCK; PEPCK-M; PEPCK2
ACCN NM_001018073
Insert Size 266 bp
Sequence Data
>SC203466 3'UTR clone of NM_001018073
The sequence shown below is from the reference sequence of NM_001018073. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCTTTCTCCACAACCTCCAACCATCTTCTAGGACTGCCAGGAGGCACAGAAGTCATGAACGTTTGCAGTT
TCCAGTCCCAGGCAAAATCTCAGTTCATGTCCCAACTCCACCAGTCACTGGTTTTGTGATCTGGCTAAGT
TGCTCAACTTCCCTAAGCTTTAGTTTCCACATCAGTTGAATGAGGGTAGTTGTGATAGTACCTATCTCAT
GAGATTGTTGGAGGATTAAATAGTGCATAAAAAGGGTTTATCACACTGACAAATAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001018073.1
Summary 'This gene encodes a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of guanosine triphosphate (GTP). A cytosolic form of this protein is encoded by a different gene and is the key enzyme of gluconeogenesis in the liver. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2014]'
Locus ID 5106

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.