CLIC1 (NM_001288) Human 3' UTR Clone

CAT#: SC203520

3`UTR clone of chloride intracellular channel 1 (CLIC1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLIC1
• Synonyms: CL1C1; G6; NCC27
• ACCN: NM_001288
• Insert Size: 290 bp
• Sequence Data:
  Insert Sequence

  >SC203520 3'UTR clone of NM_001288
  The sequence shown below is from the reference sequence of NM_001288. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCGCCTATGAGCAAGTGGCAAAGGCCCTCAAATAAGCCCCTCCTGGGACTCCCTCAACCCCCTCCATTT
  TCTCCACAAAGGCCCTGGTGGTTTCCACATTGCTACCCAATGGACACACTCCAAAATGGCCAGTGGGCAG
  GGAATCCTGGAGCACTTGTTCCGGGATGGTGTGGTGGAAGAGGGGATGAGGGAAAGAAATGGGGGGCCTG
  GGTCAGATTTTTATTGTGGGGTGGGATGAGTAGGACAACATATTTCAGTAATAAAATACAGAATAAAAAT
  CAAGTGTTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001288.4
• Summary: 'Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 1 is a member of the p64 family; the protein localizes principally to the cell nucleus and exhibits both nuclear and plasma membrane chloride ion channel activity. [provided by RefSeq, Jul 2008]'
• Locus ID: 1192