FARSLA (FARSA) (NM_004461) Human 3' UTR Clone

CAT#: SC203565

3`UTR clone of phenylalanyl-tRNA synthetase alpha subunit (FARSA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FARSA
• Synonyms: CML33; FARSL; FARSLA; FRSA; PheHA
• ACCN: NM_004461
• Insert Size: 275 bp
• Sequence Data:
  Insert Sequence

  >SC203565 3'UTR clone of NM_004461
  The sequence shown below is from the reference sequence of NM_004461. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACACAGGAGGCTGCGTGACATGGGCCACTCTAGGACAGGTCATCCTCCCCGAGTCCCTGCTGCTGCGCTC
  CTTTGCATCCCTGGCCAGTGACCTTGTATTTATGAGGCCTCTGTGAGGCCAGCCCCCACCTTCCTCTTTC
  CCACCTGTCCCAGGACCAGAATCCCAGGGACAGAGGACTGGGTAGCAGGTTCCTTCTGTTGTCCTGTGTG
  GTGTGTCTACTGTGAGGGTGGGCCCTGAGGAGACCTGTGGGCCACCTATTGTCTAATAAAGTGGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004461.2
• Summary: 'Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. This gene encodes a product which is similar to the catalytic subunit of prokaryotic and Saccharomyces cerevisiae phenylalanyl-tRNA synthetases (PheRS). This gene product has been shown to be expressed in a tumor-selective and cell cycle stage- and differentiation-dependent manner, the first member of the tRNA synthetase gene family shown to exhibit this type of regulated expression [provided by RefSeq, Jul 2008]'
• Locus ID: 2193