Junctional Adhesion Molecule 2 (JAM2) (NM_021219) Human 3' UTR Clone

CAT#: SC203582

3`UTR clone of junctional adhesion molecule 2 (JAM2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: JAM2
• Synonyms: C21orf43; CD322; JAM-B; JAMB; PRO245; VE-JAM; VEJAM
• ACCN: NM_021219
• Insert Size: 263
• Sequence Data:
  Insert Sequence

  >SC203582 3'UTR clone of NM_021219
  The sequence shown below is from the reference sequence of NM_021219. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGAAAATGATTTCAAGCACACAAAATCCTTTATAATTTAAAGACTCCACTTTAGAGATACACCAAAGCC
  ACCGTTGTTACACAAGTTATTAAACTATTATAAAACTCTGCTTTGTCCGACATTTGCAAAGAGGTACACG
  AGGAAATGGAATTGGTATTTCATTTTAATTTTCATGACTACTAACTCACCTGAACTTGCTATTTTAAACA
  AATAGTTCTGTCGACACCTAAAATATAATCTGGCTTCTTGTGTCTGGACTAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_021219.2
• Summary: This gene belongs to the immunoglobulin superfamily, and the junctional adhesion molecule (JAM) family. The protein encoded by this gene is a type I membrane protein that is localized at the tight junctions of both epithelial and endothelial cells. It acts as an adhesive ligand for interacting with a variety of immune cell types, and may play a role in lymphocyte homing to secondary lymphoid organs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
• Locus ID: 58494