BLNK (NM_013314) Human 3' UTR Clone

CAT#: SC203588

3`UTR clone of B-cell linker (BLNK) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "BLNK"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol BLNK
Synonyms AGM4; BASH; bca; BLNK-S; LY57; SLP-65; SLP65
ACCN NM_013314
Insert Size 281
Sequence Data
>SC203588 3'UTR clone of NM_013314
The sequence shown below is from the reference sequence of NM_013314. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCACCAGACTGAAGTATGCAGTTAAAGTTTCATAAAGGGGGAAAAAAAAGATCAATACCATTGCTTCAGA
CACTTTCCCAAAGTTTCTCCTTTTGAGAAAAAGTCCCAAAACTTCATATTTTGGATTATGAATCATCCAG
TAATAAAATGGAAGATGGAGTCAGCTATTGAAGTGGTCATCCATTTCTTTTTAAGAAGCTCATGTGGACT
TGTTCTATTGCCTGACCTGATGAACTGTTAATATCTGGTGAGGTTGAGTTATCATGCTACTAATATTTTC
C

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013314.3
Summary This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Locus ID 29760

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.