TRIM37 (NM_001005207) Human 3' UTR Clone

CAT#: SC203664

3`UTR clone of tripartite motif-containing 37 (TRIM37) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TRIM37"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TRIM37
Synonyms MUL; POB1; TEF3
ACCN NM_001005207
Insert Size 311 bp
Sequence Data
>SC203664 3'UTR clone of NM_001005207
The sequence shown below is from the reference sequence of NM_001005207. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAAGATCTCAGCTTCAATACAGATGAAAATAGTGGAAGATAATTTGATTTGAAACTGACACTGCACCTGA
TGGGTTAACAAGATCTAGGCTTCAGAAGGTGACAGATATGAGTGAGGACCATGTGTGGGGCAAAGCCTCA
GAATGATGAAAAGGTTCCGGCACTATAGTTGGGGCCATGTTGACTCCTTTTCAACCATTTGTCACAGACG
TGAGAAGAAGAAATGACTTCAAAATCAAGAGAAAACAAATACTGAAAGTCTCTACTTACATCCAAATTTT
AAAAAATAAAATCTGTAGATTAACAATCTGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001005207.2
Summary 'This gene encodes a member of the tripartite motif (TRIM) family, whose members are involved in diverse cellular functions such as developmental patterning and oncogenesis. The TRIM motif includes zinc-binding domains, a RING finger region, a B-box motif and a coiled-coil domain. The RING finger and B-box domains chelate zinc and might be involved in protein-protein and/or protein-nucleic acid interactions. Mutations in this gene are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder that involves several tissues of mesodermal origin. TRIM37 localizes in peroxisomal membranes, and has been implicated in human peroxisomal biogenesis disorders. [provided by RefSeq, Jul 2020]'
Locus ID 4591

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.