MRPL4 (NM_146387) Human 3' UTR Clone

CAT#: SC203670

3`UTR clone of mitochondrial ribosomal protein L4 (MRPL4) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MRPL4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MRPL4
Synonyms CGI-28; L4mt
ACCN NM_146387
Insert Size 221
Sequence Data
>SC203670 3'UTR clone of NM_146387
The sequence shown below is from the reference sequence of NM_146387. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CACCCCGTACCACTGTTGATGTGAAGCACCTCTTCTGAGCCAGGCCGAGCCCCTGGCCGACTTGGGAGCC
TCAGGCCCACGCCCACCCTTCGAGGAAGGTGTCACCTGGACCCCTTCATTCCACGGAGGAAGCTGAGGCC
ACAGGGAGCGGCCATCGCCATTGGGAAGGGGCGACTCCACGGAAAGCCCAGACGGGCTTCTGCATCCATT
CCCTCTTTTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_146387.1
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified alternatively spliced variants that encode different protein isoforms. [provided by RefSeq, Jul 2008]
Locus ID 51073

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.