delta Sarcoglycan (SGCD) (NM_172244) Human 3' UTR Clone

CAT#: SC203681

3`UTR clone of sarcoglycan delta (35kDa dystrophin-associated glycoprotein) (SGCD) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SGCD
• Synonyms: 35DAG; CMD1L; DAGD; LGMDR6; SG-delta; SGCDP; SGD
• ACCN: NM_172244
• Insert Size: 299 bp
• Sequence Data:
  Insert Sequence

  >SC203681 3'UTR clone of NM_172244
  The sequence shown below is from the reference sequence of NM_172244. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTTCCCATAACTGGTTGACCTCGGAGTTGGATCCTACAGTGTATCAACAAAAGGAGCCAAGCAGGTTTT
  ATTTCTGAAACAATTAATTGAGCAGCATGATTATAAGCCAAACCCACAATCCATCAAAGTGATGATTTCT
  TATTTGTAAAATGCAGAGATAATGGCATGTATTCCAAGTACAGAATTATATGACCATGAAAATGAATGCT
  ATTTTCAAATTCTCTCTTGTCACCTTAAAATAAGATTTTGTTAGCCAACATAATTAAGCTGTATATATTA
  TACACATCTGGCTCAAGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_172244.2
• Summary: 'The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 6444