PYGM (NM_005609) Human 3' UTR Clone

CAT#: SC203708

3`UTR clone of phosphorylase glycogen muscle (PYGM) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PYGM
• Synonyms: glycogen phosphorylase; glycogen storage disease type V; McArdle syndrome; muscle (McArdle syndrome, glycogen storage disease type V); myophosphorylase; phosphorylase, glycogen; phosphorylase, glycogen, muscle
• ACCN: NM_005609
• Insert Size: 288 bp
• Sequence Data:
  Insert Sequence

  >SC203708 3'UTR clone of NM_005609
  The sequence shown below is from the reference sequence of NM_005609. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGAGCCTTCCCGCCAGCGCCTGCCAGCCCCGGATGAGGCCATCTGAGCCTCCAGACCAGACCCCAAACC
  AGCCCTTGAGTCTGTCACACTCTCTTGGGCCAGCCCCAGCACCTCATGCAGAGGGTGGGGTACTGGAGTT
  AGATCTCTAAGCCCCTCCTGGAACCCTCATTTTCCCCACTCTCAATGTCCCAGTGTCCAGCGTGACTAAG
  GACACGGGCCCCCTTCCGTCCTCGGGCTCCCGGTCCCCTCCTATTTATGGGGTCTGACCAACTGCACCCA
  CTCCCTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005609.2
• Summary: 'This gene encodes a muscle enzyme involved in glycogenolysis. Highly similar enzymes encoded by different genes are found in liver and brain. Mutations in this gene are associated with McArdle disease (myophosphorylase deficiency), a glycogen storage disease of muscle. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]'
• Locus ID: 5837