PLCD1 (NM_006225) Human 3' UTR Clone

CAT#: SC203723

3`UTR clone of phospholipase C delta 1 (PLCD1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLCD1
• Synonyms: NDNC3; PLC-III
• ACCN: NM_006225
• Insert Size: 295 bp
• Sequence Data:
  Insert Sequence

  >SC203723 3'UTR clone of NM_006225
  The sequence shown below is from the reference sequence of NM_006225. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCCATCAGCCACCCTCTTTGTGAAGATCTCCCTCCAGGACTAGGCTGGAGGAAGCCAGTGGGGTCCCCC
  CTGAGTGGGCTGGGCCCTCTGTCCACATGTGGGGACAGGGCTGGTGTGGCTGCTCCCAGCCTCTTGCTCA
  GAGCTAGGCCCCCAAATTGCCTTCAGCCCTAACATAGTGTCTGCTGCTGCCTCCCTGGGGACCAGGAGCT
  AGCCCAGTCCCTGGAGCTGTCCTTCATTCCGTTAGGAATAACACTGCAGCCCTCTCCACCCTCCGGCCAG
  CGAGTGGTCAAGGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006225.3
• Summary: 'This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]'
• Locus ID: 5333