GAS2L1 (NM_152236) Human 3' UTR Clone

CAT#: SC203725

3`UTR clone of growth arrest-specific 2 like 1 (GAS2L1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GAS2L1
• Synonyms: GAR22
• ACCN: NM_152236
• Insert Size: 293
• Sequence Data:
  Insert Sequence

  >SC203725 3'UTR clone of NM_152236
  The sequence shown below is from the reference sequence of NM_152236. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCAGATTCCTGGATGTGATGGACCAGCTCAGCTGTCCCCAGACCCCATCCCTTCTCCTTTTCCTTTGTG
  GCCTTAACCCTTCTGCATCAGGGAGCCCCCTCTGCCTCTTGAGTACCAGACCTCATGGGACCAGACCCCT
  TGGGACCACATGGCACAATGGGACCTCTGTTGTACATTCCGGTTGGGGGATGAGCGTTGCTATTTAATTA
  CTAATATTATTGAATGCCTTAGAGGAGGCCGGGCGAGCCCGGTGTTCTGAAGACCTGTGGCCCAGCAGAG
  CCTCTGACAGTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_152236.1
• Summary: This gene encodes a member of the growth arrest-specific 2 protein family. This protein binds components of the cytoskeleton and may be involved in mediating interactions between microtubules and microfilaments. This protein localizes to the proximal end of mature centrioles and links centrosomes to both microtubules and actin. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 9. [provided by RefSeq, May 2018]
• Locus ID: 10634