PSMA4 (NM_001102668) Human 3' UTR Clone

CAT#: SC203773

3`UTR clone of proteasome (prosome macropain) subunit alpha type 4 (PSMA4) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PSMA4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PSMA4
Synonyms HC9; HsT17706; PSC9
ACCN NM_001102668
Insert Size 320 bp
Sequence Data
>SC203773 3'UTR clone of NM_001102668
The sequence shown below is from the reference sequence of NM_001102668. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGAGCGTGAGAAGAAAGAAAAAGAACAGAAAGAAAAGGATAAATAGAATCAGAGATTTTATTACTCATT
TGGGGCACCATTTCAGTGTAAAAGCAGTCCTACTCTTCCACACTAGGAAGGCTTTACTTTTTTTAACTGG
TGCAGTGGGAAAATAGGACATTACATACTGAATTGGGTCCTTGTCATTTCTGTCCAATTGAATACTTTAT
TGTAACGATGATGGTTACCCTTCATGGACGTCTTAATCTTCCACACACATCCCCTTTTTTTGGAATAAAA
TTTGGAAAATGGAAATGAAGGAATAAATTCTCTGTAGCAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001102668.1
Summary 'This gene encodes a core alpha subunit of the 20S proteosome, which is a highly ordered ring-shaped structure composed of four rings of 28 non-identical subunits. Proteasomes cleave peptides in an ATP- and ubiquitin-dependent manner. [provided by RefSeq, Aug 2016]'
Locus ID 5685

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.