PSMA4 (NM_002789) Human 3' UTR Clone

CAT#: SC203777

3`UTR clone of proteasome (prosome macropain) subunit alpha type 4 (PSMA4) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSMA4
• Synonyms: HC9; HsT17706; PSC9
• ACCN: NM_002789
• Insert Size: 320 bp
• Sequence Data:
  Insert Sequence

  >SC203777 3'UTR clone of NM_002789
  The sequence shown below is from the reference sequence of NM_002789. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGAGCGTGAGAAGAAAGAAAAAGAACAGAAAGAAAAGGATAAATAGAATCAGAGATTTTATTACTCATT
  TGGGGCACCATTTCAGTGTAAAAGCAGTCCTACTCTTCCACACTAGGAAGGCTTTACTTTTTTTAACTGG
  TGCAGTGGGAAAATAGGACATTACATACTGAATTGGGTCCTTGTCATTTCTGTCCAATTGAATACTTTAT
  TGTAACGATGATGGTTACCCTTCATGGACGTCTTAATCTTCCACACACATCCCCTTTTTTTGGAATAAAA
  TTTGGAAAATGGAAATGAAGGAATAAATTCTCTGTAGCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002789.4
• Summary: 'This gene encodes a core alpha subunit of the 20S proteosome, which is a highly ordered ring-shaped structure composed of four rings of 28 non-identical subunits. Proteasomes cleave peptides in an ATP- and ubiquitin-dependent manner. [provided by RefSeq, Aug 2016]'
• Locus ID: 5685