E3 SUMO protein ligase PIAS4 (PIAS4) (NM_015897) Human 3' UTR Clone

CAT#: SC203791

3`UTR clone of protein inhibitor of activated STAT 4 (PIAS4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PIAS4
• Synonyms: PIAS-gamma; Piasg; PIASY; ZMIZ6
• ACCN: NM_015897
• Insert Size: 205
• Sequence Data:
  Insert Sequence

  >SC203791 3'UTR clone of NM_015897
  The sequence shown below is from the reference sequence of NM_015897. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGCCCCTTCCAGAAGGGCCTGGTGCCGGCCTGCTGACCCCGGCCGCACACTCGACTTTCCTGGTGCTC
  ACCACGCAGAGGGGCACGGGCCAGCCTCGGGCGCAGAGGGAGGAGTGACCTTTCTTTTTCTTTTTATTGT
  CGTTCGTTTTGTTTTTCCACCCTTTTGCCTGGCTCCTGGCACCTGTACCTCTGGACTCTCCTATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_015897.2
• Locus ID: 51588