Glutathione S Transferase kappa 1 (GSTK1) (NM_015917) Human 3' UTR Clone

CAT#: SC203808

3`UTR clone of glutathione S-transferase kappa 1 (GSTK1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GSTK1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GSTK1
Synonyms GST; GST13; GST 13-13; GST13-13; GSTK1-1; hGSTK1
ACCN NM_015917
Insert Size 305
Sequence Data
>SC203808 3'UTR clone of NM_015917
The sequence shown below is from the reference sequence of NM_015917. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATACCTCCAGCCGTGAATGCCAGACTTTAAGATTGCCCGGAGGAAGCAAACTCTTCGTATAAAAAAAGCA
GGCCATCTGCTTAACCCTTGGCTCCACCATAAGGCACTGGGACTCGGATTTCTCTATCTGATAGAGGTAT
TTTCTGTGGCCCTGGGAGCTGTCTGTCTTTCCCCTACCCCCAAGGATGCCAGGAAGACGTCCACCATTAG
CCATGTGGCAACCTTTACTTCTATGCCTCACAAGTGCCTTTCAGAGAGCCCCAATTCTGCTTTCCCACAA
AATAAACCTAATGCCATCAGGCAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015917.2
Summary This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Locus ID 373156

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.