GNA11 (NM_002067) Human 3' UTR Clone

CAT#: SC203813

3`UTR clone of guanine nucleotide binding protein (G protein) alpha 11 (Gq class) (GNA11) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GNA11
• Synonyms: FBH; FBH2; FHH2; GNA-11; HHC2; HYPOC2
• ACCN: NM_002067
• Insert Size: 291 bp
• Sequence Data:
  Insert Sequence

  >SC203813 3'UTR clone of NM_002067
  The sequence shown below is from the reference sequence of NM_002067. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCAAGGAGTACAACCTGGTCTGAGCGCCCAGGCCCAGGGAGACGGGATGGAGACACGGGGCAGGACCTT
  CCTTCCACGGAGCCTGCGGCTGCCGGGCGGGTGGCGCTGCCGAGTCCGGGCCGGGGCCTCTGCCCGCGGG
  AGGAGATTTTTTTTTTTCATATTTTTAACAAATGGTTTTTATTTCACAGTTATCAGGGGATGTACATCTC
  TCCCTCCGTACACTTCGCGCACCTTCTCACCTTTTGTCAACGGCAAAGGCAGCCTTTTTCTGGCCTTGAC
  TTATGGCTCGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002067.2
• Summary: 'The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations. [provided by RefSeq, Dec 2013]'
• Locus ID: 2767