HSD17B1 (NM_000413) Human 3' UTR Clone

CAT#: SC203818

3`UTR clone of hydroxysteroid (17-beta) dehydrogenase 1 (HSD17B1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSD17B1
• Synonyms: 17-beta-HSD; 20-alpha-HSD; E2DH; EDH17B2; EDHB17; HSD17; SDR28C1
• ACCN: NM_000413
• Insert Size: 282 bp
• Sequence Data:
  Insert Sequence

  >SC203818 3'UTR clone of NM_000413
  The sequence shown below is from the reference sequence of NM_000413. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGAGCTCGGCGATCCTCCGGCCGCCCCGCAGTAAAGGCTTCCTCAGCCGCTGTCTCCCGCGCCCTTCTT
  TGTCCCCTGGGTCTGTGTGGTCCCTGGGGATGGGGCGGCGGTAGCAGCTGTGGGTGGCTAATTAAGATAG
  ATCGCGTTAGCCAGTTTTACCAGCGCAGCTAGGCGCGATGGCTGTCGCCTGTAATGCCAGCGCTTTGGGA
  GGCGGAGGCAGGAGGATCGCTCAAGCCCCGGAGTTGGAGACCAGCCAGAGCAACACAGTGAGACCCCCAT
  CT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000413.2
• Summary: 'This gene encodes a member of the 17beta-hydroxysteroid dehydrogenase family of short-chain dehydrogenases/reductases. It has a dual function in estrogen activation and androgen inactivation and plays a major role in establishing the estrogen E2 concentration gradient between serum and peripheral tissues. The encoded protein catalyzes the last step in estrogen activation, using NADPH to convert estrogens E1 and E2 and androgens like 4-androstenedione, to testosterone. It has an N-terminal short-chain dehydrogenase domain with a cofactor binding site, and a narrow, hydrophobic C-terminal domain with a steroid substrate binding site. This gene is expressed primarily in the placenta and ovarian granulosa cells, and to a lesser extent, in the endometrium, adipose tissue, and prostate. Polymorphisms in this gene have been linked to breast and prostate cancer. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]'
• Locus ID: 3292