CACNG2 (NM_006078) Human 3' UTR Clone

CAT#: SC203825

3`UTR clone of calcium channel voltage-dependent gamma subunit 2 (CACNG2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CACNG2
• Synonyms: MRD10
• ACCN: NM_006078
• Insert Size: 314
• Sequence Data:
  Insert Sequence

  >SC203825 3'UTR clone of NM_006078
  The sequence shown below is from the reference sequence of NM_006078. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCACTCCAACACAGCCAACCGCCGGACCACCCCCGTATAAAGACCGCGGGCCTCGCCAGAAGACCGCGG
  GAGGAGGGCGCGGTCCCCGGGGGCGGGGCGGGGCGGGGAGACCCAGACCCTCCGCTGGGAGACCTTCCAA
  AAGCAAAAACAAAAAACAAAAAAAACAAAAAAACAAAAAACAAAAAAACACACACACACAAAAAAAGAGA
  AAAAACATAACAAGTAAATTTTAAAAAAAAGAACAAAATATAAGAGGAACAAAGAAGCAAAACAACAGGA
  AATGTGGGAAAATATAAACGAGGGAAGAAAACAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006078.2
• Summary: The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. The AMPA subtype of ionotropic glutamate receptors are ligand gated ion channels that are typically activated by glutamate released from presynaptic neuron terminals and mediate fast neurotransmission in excitatory synapses. TARPs thus play an important role in synaptic plasticity, learning and memory. Mutations in this gene cause an autosomal dominant form of cognitive disability. [provided by RefSeq, Jul 2017]
• Locus ID: 10369