Cathepsin V (CTSV) (NM_001333) Human 3' UTR Clone

CAT#: SC203833

3`UTR clone of cathepsin L2 (CTSL2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CTSV
• Synonyms: CATL2; CTSL2; CTSU
• ACCN: NM_001333
• Insert Size: 319 bp
• Sequence Data:
  Insert Sequence

  >SC203833 3'UTR clone of NM_001333
  The sequence shown below is from the reference sequence of NM_001333. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAACCACTGTGGAATCGCCACAGCAGCCAGCTACCCCAATGTGTGAGCTGATGGATGGTGAGGAGGAAG
  GACTTAAGGACAGCATGTCTGGGGAAATTTTATCTTGAAACTGACCAAACGCTTATTGTGTAAGATAAAC
  CAGTTGAATCATTGAGGATCCAAGTTGAGATTTTAATTCTGTGACATTTTTACAAGGGTAAAATGTTACC
  ACTACTTTAATTATTGTTATACACAGCTTTATGATATCAAAGACTCATTGCTTAATTCTAAGACTTTTGA
  ATTTTCATTTTTTAAAAAGATGTACAAAACAGTTTGAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001333.2
• Summary: 'The protein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that may play an important role in corneal physiology. This gene is expressed in colorectal and breast carcinomas but not in normal colon, mammary gland, or peritumoral tissues, suggesting a possible role for this gene in tumor processes. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2011]'
• Locus ID: 1515