ATP6V0B (NM_004047) Human 3' UTR Clone

CAT#: SC203915

3`UTR clone of ATPase H+ transporting lysosomal 21kDa V0 subunit b (ATP6V0B) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATP6V0B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ATP6V0B
Synonyms ATP6F; HATPL; VMA16
ACCN NM_004047
Insert Size 325
Sequence Data
>SC203915 3'UTR clone of NM_004047
The sequence shown below is from the reference sequence of NM_004047. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTTCAGACCTCCAGAGTGAAGATGGGTGACTAGATGATATGTGTGGGTGGGGCCGTGCCTCACTTTTAT
TTATTGCTGGTTTTCCTGGGACAGCTGGAGCTGTGTCCCTTAGCCTTTCAGAGGCTTGGTGTTCAGGGCC
CTCCCTGCACTCCCCTCTTGCTGCGTGTTGATTTGGAGGCACTGCAGTCCAGGCCGAGTCCTCAGTGCGG
GGAGCAGGCTGCTGCTGCTGACTCTGTGCAGCTGCGCACCTGTGTCCCCCACCTCCACCCTCAACCCATC
TTCCTAGTGTTTGTGAAATAAACTTGGTATTTGTCTGGGTCAGTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004047.3
Summary This gene encodes a portion of the V0 domain of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Activity of this enzyme is necessary for such varied processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Locus ID 533

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.