ULK2 (NM_001142610) Human 3' UTR Clone

CAT#: SC203984

3`UTR clone of unc-51-like kinase 2 (C. elegans) (ULK2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ULK2
• Synonyms: ATG1B; Unc51.2
• ACCN: NM_001142610
• Insert Size: 303
• Sequence Data:
  Insert Sequence

  >SC203984 3'UTR clone of NM_001142610
  The sequence shown below is from the reference sequence of NM_001142610. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTGCCATAGCACCGCAACCGTGTGAGCAGCAGGCTCATCCCGTGGACCGGTGGTGGGAACGTGAGGAAG
  AGGGGAAGGAAGGAAGAGCTTTTCCATTTGGTGCTCCAATGTCTCCTGCTGGACCCATCTGCCTAGTGGA
  AGGCAGCAAAATTTCAAGAAACAGGTGAGGTTGAGCAGCTTGGTGCAACCCCATGGGGCCTGGAGTTGGA
  GCTCAACAGCAATGGATTTCAGAGACCACCCTGAAACTCCCAGTAAAAAAGACTTGGGAGACATGTTAAT
  AAACTCAAGCATTTGATCGACCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001142610.1
• Summary: This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008]
• Locus ID: 9706