PRPF31 (NM_015629) Human 3' UTR Clone

CAT#: SC204000

3`UTR clone of PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae) (PRPF31) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRPF31
• Synonyms: NY-BR-99; PRP31; RP11; SNRNP61
• ACCN: NM_015629
• Insert Size: 325
• Sequence Data:
  Insert Sequence

  >SC204000 3'UTR clone of NM_015629
  The sequence shown below is from the reference sequence of NM_015629. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGGTCAAGGGCGAGAAGAGTGGCCTTATGTCCACCTGAATGACTGCGTGTGTCCAAGGTGGCTTCCCAC
  TGAAGGGACACAGAGGTCCAGTCCTTCTGAAGGGCTAGGATCGGGTTCTGGCAGGGAGAACCTGCCCTGC
  CACTGGCCCCATTGCTGGGACTGCCCAGGGAGGAGGCCTTGGAAGAGTCCGGCCTGGCCTCCCCCAGGAC
  CGAGATCACCGCCCAGTATGGGCTAGAGCAGGTCTTCATCATGCCTTGTCTTTTTTAACTGAGAAAGGAG
  ATTTTTTGAAAAGAGTACAATTAAAAGGACATTGTCAAGATCTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_015629.3
• Summary: This gene encodes a component of the spliceosome complex and is one of several retinitis pigmentosa-causing genes. When the gene product is added to the spliceosome complex, activation occurs. [provided by RefSeq, Jan 2009]
• Locus ID: 26121