PIGC (NM_002642) Human 3' UTR Clone

CAT#: SC204044

3`UTR clone of phosphatidylinositol glycan anchor biosynthesis class C (PIGC) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PIGC
• Synonyms: GPI2; GPIBD16; MRT62
• ACCN: NM_002642
• Insert Size: 281 bp
• Sequence Data:
  Insert Sequence

  >SC204044 3'UTR clone of NM_002642
  The sequence shown below is from the reference sequence of NM_002642. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGGAAGACTTGTCCAGGTTCCTCAGTTAAATTAGGACATCCATTACATTATTAAAGCAAGCTGATAGA
  TTAGCCTCCTAACTAGTATAGAACTTAAAGACAGAGTTCCATTCTGGAAGCAGCATGTCATTGTGGTAAG
  AGAATAGAGATCAAAACCAAAAAAAATGAACCAAAGGCTTGGGTGGTGAGGGTGCTTATCCTTTCTGTTA
  TTTTGTAGATGAAAAAACTTTCTGGGGACCTCTTGAATTACATGCTGTAACATATGAAGTGATGTGGTTT
  C
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002642.3
• Summary: 'This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI) lipid anchor biosynthesis. The GPI lipid anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. The encoded protein is one subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. Two alternatively spliced transcripts that encode the same protein have been found for this gene. A pseudogene on chromosome 11 has also been characterized. [provided by RefSeq, Jul 2008]'
• Locus ID: 5279