PLAUR (NM_002659) Human 3' UTR Clone

CAT#: SC204061

3`UTR clone of plasminogen activator urokinase receptor (PLAUR) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLAUR
• Synonyms: CD87; U-PAR; UPAR; URKR
• ACCN: NM_002659
• Insert Size: 328 bp
• Sequence Data:
  Insert Sequence

  >SC204061 3'UTR clone of NM_002659
  The sequence shown below is from the reference sequence of NM_002659. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTCTCCTCTGGACCTAAACCTGAAATCCCCCTCTCTGCCCTGGCTGGATCCGGGGGACCCCTTTGCCCT
  TCCCTCGGCTCCCAGCCCTACAGACTTGCTGTGTGACCTCAGGCCAGTGTGCCGACCTCTCTGGGCCTCA
  GTTTTCCCAGCTATGAAAACAGCTATCTCACAAAGTTGTGTGAAGCAGAAGAGAAAAGCTGGAGGAAGGC
  CGTGGGCCAATGGGAGAGCTCTTGTTATTATTAATATTGTTGCCGCTGTTGTGTTGTTGTTATTAATTAA
  TATTCATATTATTTATTTTATACTTACATAAAGATTTTGTACCAGTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002659.2
• Summary: 'This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]'
• Locus ID: 5329