ARPC1B (NM_005720) Human 3' UTR Clone

CAT#: SC204111

3`UTR clone of actin related protein 2/3 complex subunit 1B 41kDa (ARPC1B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ARPC1B
• Synonyms: ARC41; p40-ARC; p41-ARC; PLTEID
• ACCN: NM_005720
• Insert Size: 308
• Sequence Data:
  Insert Sequence

  >SC204111 3'UTR clone of NM_005720
  The sequence shown below is from the reference sequence of NM_005720. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTGGAGTCAGCCTTGAAGGACCTCAAGATCAAATGACCTGTGAGGAATATGTTGCCTTCATCCTAGCTGC
  TGGGGAAGCGGGGAGAGGGGTCAGGGAGGCTAATGGTTGCTTTGCTGAATGTTTCTGGGGTACCAATACG
  AGTTCCCATAGGGGCTGCTCCCTCAAAAAGGGAGGGGACAGATGGGGAGCTTTTCTTACCTATTCAAGGA
  ATACGTGCCTTTTTCTTAAATGCTTTCATTTATTGAAAAAAAAAAAAAATGCCCCCAAAGCACTATGCTG
  GTCATGAACTGCTTCAAAATGTGGAGGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005720.2
• Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
• Locus ID: 10095