HLA-DRB3 (NM_022555) Human 3' UTR Clone

CAT#: SC204177

3`UTR clone of major histocompatibility complex class II DR beta 3 (HLA-DRB3) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HLA-DRB3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HLA-DRB3
Synonyms DRB3; HLA-DPB1; HLA-DR1B; HLA-DR3B
ACCN NM_022555
Insert Size 354 bp
Sequence Data
>SC204177 3'UTR clone of NM_022555
The sequence shown below is from the reference sequence of NM_022555. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACACTCTGGACTTCAGCCAACAGGATTCCTGAGCTGAAGTGCAGATGACAATTTAAGGAAGAATCTTCTG
CCCCAGCTTTGCAGGATGAAAAGCTTTCCCGCCTGGCTGTTATTCTTCCACGAGAGAGGGCTTTCTCAGG
ACCTAGTTGCTACTGGTTCAGCAACTGCAGAAAATGTCCTCCCTTGTGGCTTCCTCAGTTCCTGCCCTTG
GCCTGAAGTCCCAGCATTGATGGCAGCGCCTCATCTTCAACTTTTGTGCTCCCCTTTGCCTAAACCCTAT
GGCCTCCTGTGCATCTGTACTCACCCTGTACCACAAACACATTACATTATTAAATGTTTCTCAAAGATGG
AGTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_022555.3
Summary 'HLA-DRB3 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. There are multiple pseudogenes of this gene. [provided by RefSeq, Feb 2020]'
Locus ID 3125

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.