VMAT2 (SLC18A2) (NM_003054) Human 3' UTR Clone

CAT#: SC204181

3`UTR clone of solute carrier family 18 (vesicular monoamine) member 2 (SLC18A2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SLC18A2
• Synonyms: PKDYS2; SVAT; SVMT; VAT2; VMAT2
• ACCN: NM_003054
• Insert Size: 363 bp
• Sequence Data:
  Insert Sequence

  >SC204181 3'UTR clone of NM_003054
  The sequence shown below is from the reference sequence of NM_003054. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGTCATATCCGATAGGTGAAGATGAAGAATCTGAAAGTGACTGAGATGAGATCCTCAAAAATCATCAA
  AGTGTTTAATTGTATAAAACAGTGTTTCCAGTGACACAACTCATCCAGAACTGTCTTAGTCATACCATCC
  ATCCCTGGTGAAAGAGTAAAACCAAAGGTTATTATTTCCTTTCCATGGTTATGGTCGATTGCCAACAGCC
  TTATAAAGAAAAAGAAGCTTTTCTAGGGGTTTGTATAAATAGTGTTGAAACTTTATTTTATGTATTTAAT
  TTTATTAAATATCATACAATATATTTTGATGAAATAGGTATTGTGTAAATCTATAAATATTTGAATCCAA
  ACCAAATATAATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003054.3
• Summary: 'This gene encodes an transmembrane protein that functions as an ATP-dependent transporter of monoamines, such as dopamine, norepinephrine, serotonin, and histamine. This protein transports amine neurotransmitters into synaptic vesicles. Polymorphisms in this gene may be associated with schizophrenia, bipolar disorder, and other neurological/psychiatric ailments. [provided by RefSeq, Jun 2018]'
• Locus ID: 6571