TYK2 (NM_003331) Human 3' UTR Clone

CAT#: SC204234

3`UTR clone of tyrosine kinase 2 (TYK2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TYK2
• Synonyms: IMD35; JTK1
• ACCN: NM_003331
• Insert Size: 301 bp
• Sequence Data:
  Insert Sequence

  >SC204234 3'UTR clone of NM_003331
  The sequence shown below is from the reference sequence of NM_003331. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGTGTTCAGCGTGTGCTGAGGCACAATGGCAGCCCTGCCTGGGAGGACTGGACCAGGCAGTGGCTGCAG
  AGGGAGCCTCCTGCTCCCTGCTCCAGGATGAAACCAAGAGGGGGATGTCAGCCTCACCCACACCGTGTGC
  CTTACTCCTGTCTAGAGACCCCACCTCTGTGAACTTATTTTTCTTTCTTGGCCGTGAGCCTAACCATGAT
  CTTGAGGGACCCAACATTTGTAGGGGCACTAATCCAGCCCTTAAATCCCCCAGCTTCCAAACTTGAGGCC
  CACCATCTCCACCATCTGGTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003331.4
• Summary: 'This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with Immunodeficiency 35. [provided by RefSeq, Jul 2020]'
• Locus ID: 7297