Mps1 (TTK) (NM_003318) Human 3' UTR Clone

CAT#: SC204305

3`UTR clone of TTK protein kinase (TTK) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TTK
• Synonyms: CT96; ESK; MPH1; MPS1; MPS1L1; PYT
• ACCN: NM_003318
• Insert Size: 366 bp
• Sequence Data:
  Insert Sequence

  >SC204305 3'UTR clone of NM_003318
  The sequence shown below is from the reference sequence of NM_003318. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTCATCCTCCAAGACTTTTGAAAAAAAAAGGGGAAAAAAATGATTTGCAGTTATTCGTAATGTCAGATA
  CCACCTATAAAATATATTGGACTGTTATACTCTTGAATCCCTGTGGAAATCTACATTTGAAGACAACATC
  ACTCTGAAGTGTTATCAGCAAAAAAAATTCAGTAGATTATCTTTAAAAGAAAACTGTAAAAATAGCAACC
  ACTTATGGCACTGTATATATTGTAGACTTGTTTTCTCTGTTTTATGCTCTTGTGTAATCTACTTGACATC
  ATTTTACTCTTGGAATAGTGGGTGGATAGCAAGTATATTCTAAAAAACTTTGTAAATAAAGTTTTGTGGC
  TAAAATGACACTAACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003318.4
• Summary: 'This gene encodes a dual specificity protein kinase with the ability to phosphorylate tyrosine, serine and threonine. Associated with cell proliferation, this protein is essential for chromosome alignment at the centromere during mitosis and is required for centrosome duplication. It has been found to be a critical mitotic checkpoint protein for accurate segregation of chromosomes during mitosis. Tumorigenesis may occur when this protein fails to degrade and produces excess centrosomes resulting in aberrant mitotic spindles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]'
• Locus ID: 7272