Glutathione S Transferase theta 2 (GSTT2) (NM_000854) Human 3' UTR Clone

CAT#: SC204309

3`UTR clone of glutathione S-transferase theta 2 (GSTT2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSTT2
• ACCN: NM_000854
• Insert Size: 334 bp
• Sequence Data:
  Insert Sequence

  >SC204309 3'UTR clone of NM_000854
  The sequence shown below is from the reference sequence of NM_000854. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCAGGCTATGCTGCTTCGAATCGCCAGGATCCCCTGAAGGGTCTGGGATGGGGGCCAGGAGATTAGCAAC
  AAGGATTCATTCTGTTACTTACTTGCCCCTTTTTATCTTTCCCTCTTGCCCCAGTCCCTTCTCTCCAGCT
  TCATGTGAAGCTCTGCACAGACAAGACACTCAGTGTCCTTGGCAGTGCTGCTACTCCTCAGGTGCAGCAT
  ACATAACCAGTAAGAGACTAAATCTGCAATATATAAAGAGCTCCTACAAATCAGTAACATGAAGAACACT
  CAAAAATTGGCAAATGTCATCAGTGTTTTAAACAGAATAAAGATTCCAAACACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000854.3
• Summary: 'The protein encoded by this gene, glutathione S-transferase (GST) theta 2 (GSTT2), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT2 and GSTT2B are nearly identical to each other, and share 55% amino acid identity with GSTT1. All three genes may play a role in human carcinogenesis. The GSTT2 gene is a pseudogene in some populations. [provided by RefSeq, Sep 2015]'
• Locus ID: 2953