Clathrin light chain (CLTA) (NM_001076677) Human 3' UTR Clone

CAT#: SC204314

3`UTR clone of clathrin light chain (Lca) (CLTA) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CLTA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CLTA
Synonyms LCA
ACCN NM_001076677
Insert Size 296 bp
Sequence Data
>SC204314 3'UTR clone of NM_001076677
The sequence shown below is from the reference sequence of NM_001076677. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCATCTCCCTCAAGCAGGCCCCGCTGGTGCACTGAAGAGCCACCCTGTGGAAACACTACATCTGCAATAT
CTTAATCCTACTCAGTGAAGCTCTTCACAGTCATTGGATTAATTATGTTGAGTTCTTTTGGACCAAACCT
TTTTGTCTTTAGAGTTGTTCATTGTTTGTGATTGCATGTTTCCTTCCTTCAACTGTGTTCTCCCTGGCAT
TCAGAGAGGAGGGAGAGGAGGAAGAGGAAGGGGAGGGAAGCTTCCCAAGAGTAGCCTCAACCTGTGCTTC
TGTGCATTATTCTGAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001076677.1
Summary 'Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, May 2010]'
Locus ID 1211

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.