ATP6V1B1 (NM_001692) Human 3' UTR Clone

CAT#: SC204335

3`UTR clone of ATPase H+ transporting lysosomal 56/58kDa V1 subunit B1 (ATP6V1B1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP6V1B1
• Synonyms: ATP6B1; RTA1B; VATB; VMA2; VPP3
• ACCN: NM_001692
• Insert Size: 303 bp
• Sequence Data:
  Insert Sequence

  >SC204335 3'UTR clone of NM_001692
  The sequence shown below is from the reference sequence of NM_001692. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCTGACACTGCGCTCTAGCCCCGCGCGCCGTGGCACCCCAACACCGGCAGGGAACCTACCCTCGGCTCC
  CGGGTCTCCCCTCCCTCGCCACCCCAACCAGCGGCTTCTGCGCCGCCCTCCGCCCTCCGCTGGCTCCGAG
  GTGGTGGGGGCGCCGCACGCTCCATCCCTTTCCCTCGCTCGATTCCTTTTCCCGCGCTCCATGCCTCCCC
  CTCGACTCCCGGTGCTGCGGAAGAACTGAAGGTTGCGATGCCTTACTCTGACGGGAGCATCTGTATTTTT
  ATGTTAAAAGCCCACAAAATAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001692.3
• Summary: 'This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain B subunit isoforms and is found in the kidney. Mutations in this gene cause distal renal tubular acidosis associated with sensorineural deafness. [provided by RefSeq, Jul 2008]'
• Locus ID: 525