AlaRS (AARS) (NM_001605) Human 3' UTR Clone

CAT#: SC204343

3`UTR clone of alanyl-tRNA synthetase (AARS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AARS
• Synonyms: CMT2N; EIEE29
• ACCN: NM_001605
• Insert Size: 368 bp
• Sequence Data:
  Insert Sequence

  >SC204343 3'UTR clone of NM_001605
  The sequence shown below is from the reference sequence of NM_001605. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCACTTCCTTCGCCCAGCTGCGCCTCGGGGATGTAAAGAACTGAGTGGGGAAGGAGGAGGCTCCCACTG
  GATCCATCCGTCCAGCCAAGAGCTCTTCATCTGCTACAAGAACATTTGAATCTTGGGACCTTTAAAGAGC
  CCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGAGCAGTCCTATGTCTCAGTGCCCCTTAAATTTCT
  GCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGC
  TCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGTTTTTGCTGC
  AGAGAATAAAAGGACCAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001605.2
• Summary: 'The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]'
• Locus ID: 16