EXOSC8 (NM_181503) Human 3' UTR Clone

CAT#: SC204399

3`UTR clone of exosome component 8 (EXOSC8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EXOSC8
• Synonyms: bA421P11.3; CIP3; EAP2; OIP2; p9; PCH1C; RRP43; Rrp43p
• ACCN: NM_181503
• Insert Size: 309
• Sequence Data:
  Insert Sequence

  >SC204399 3'UTR clone of NM_181503
  The sequence shown below is from the reference sequence of NM_181503. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TAAGAGTATGAAACCCAAATAAACAGCCACCACATTTTCAAAACAGATTTGTAAAAATTGTATTTGTTAA
  CACTGTGCACAAACGTTTTATACTAAATAAATATCAAACTACATTCTTCTGAAAGATGTTTCTATTATTT
  CTTAGGTCACTTCCATATATATTATGTATAGTGAAACCATTTTTAAAAAGCAATGACTTAGGCAAACCAA
  CCCTAGTTTGTTAAACCATTTCCCTGTTTTTATTTAAAAATGATAAGGTTGTGCTTCTGTATAAAGTTTG
  TACATCTAGCAATGTAAAATACTGACACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_181503.2
• Summary: This gene encodes a 3'-5' exoribonuclease that specifically interacts with mRNAs containing AU-rich elements. The encoded protein is part of the exosome complex that is important for the degradation of numerous RNA species. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2009]
• Locus ID: 11340