GBA2 (NM_020944) Human 3' UTR Clone

CAT#: SC204413

3`UTR clone of glucosidase beta (bile acid) 2 (GBA2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GBA2
• Synonyms: AD035; NLGase; SPG46
• ACCN: NM_020944
• Insert Size: 324
• Sequence Data:
  Insert Sequence

  >SC204413 3'UTR clone of NM_020944
  The sequence shown below is from the reference sequence of NM_020944. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTTGGACCAAAGGAAGCCATGGCAAACCTGAGCCCAGAGTGAGCCGTCTGAACTGTGGGAGGGAAGTGC
  TAACAGCCCAGCCTCCAGCCTGGCCTTTCCTCCTTCCCCTCTGAACCTCCTGCAACCCTGAGCCATCAGG
  ACAATCATACCCCTTCCCTTCTCTCCACCCAATTGTGCCAGTAAATGGGGGTTGAGGGTGACCTAGGCAG
  CATTAGAATCACTTATTTATTTCTTTCCTCACCTGTTCCCTGACTGCGTGAAATGTTCAGGGAGGTCAGT
  TGATTTCCCCAGGTACATTCATGGTGTGACAGACACATGGGTAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_020944.2
• Summary: This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
• Locus ID: 57704