NAT2 (NM_000015) Human 3' UTR Clone

CAT#: SC204473

3`UTR clone of N-acetyltransferase 2 (arylamine N-acetyltransferase) (NAT2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NAT2
• Synonyms: AAC2; NAT-2; PNAT
• ACCN: NM_000015
• Insert Size: 367
• Sequence Data:
  Insert Sequence

  >SC204473 3'UTR clone of NM_000015
  The sequence shown below is from the reference sequence of NM_000015. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAACCTGGTGATGGATCCCTTACTATTTAGAATAAGGAACAAAATAAACCCTTGTGTATGTATCACCCA
  ACTCACTAATTATCAACTTATGTGCTATCAGATATCCTCTCTACCCTCACGTTATTTTGAAGAAAATCCT
  AAACATCAAATACTTTCATCCATAAAAATGTCAGCATTTATTAAAAAACAATAACTTTTTAAAGAAACAT
  AAGGACACATTTTCAAATTAATAAAAATAAAGGCATTTTAAGGATGGCCTGTGATTATCTTGGGAAGCAG
  AGTGATTCATGCTAGAAAACATTTAATATTGATTTATTGTTGAATTCATAGTAAATTTTTACTGGTAAAT
  GAATAAAGAATATTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_000015.2
• Summary: This gene encodes an enzyme that functions to both activate and deactivate arylamine and hydrazine drugs and carcinogens. Polymorphisms in this gene are responsible for the N-acetylation polymorphism in which human populations segregate into rapid, intermediate, and slow acetylator phenotypes. Polymorphisms in this gene are also associated with higher incidences of cancer and drug toxicity. A second arylamine N-acetyltransferase gene (NAT1) is located near this gene (NAT2). [provided by RefSeq, Jul 2008]
• Locus ID: 10