Adenine Nucleotide Translocator 2 (SLC25A5) (NM_001152) Human 3' UTR Clone

CAT#: SC204503

3`UTR clone of solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator) member 5 (SLC25A5) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC25A5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SLC25A5
Synonyms 2F1; AAC2; ANT2; T2; T3
ACCN NM_001152
Insert Size 360 bp
Sequence Data
>SC204503 3'UTR clone of NM_001152
The sequence shown below is from the reference sequence of NM_001152. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGCTTTTGTGCTTGTCTTGTATGATGAAATCAAGAAGTACACATAAGTTATTTCCTAGGATTTTTCCCC
CTGTGAACAGGCATGTTGTATTATATAACATATCTTGAGCATTCTTGACAGACTCCTGGCTGTCAGTTTC
TCAGTGGCAACTATTTACTGGTTGAAAATGGGAAGCAATAATATTCATCTGACCAGTTTTCTCTTAAAGC
CATTTCCATGATGATGATGATGGGACTCAATTGTATTTTTTATTTCAGTCACTCCTGATAAATAACAAAT
TTGGAGAAATAAAAATATCTAAAATAAATTTTGTCTGCAGTATATTTTCATATAAAAATGCATATTTGAG
TGCTACATTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001152.4
Summary 'This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Suppressed expression of this gene has been shown to induce apoptosis and inhibit tumor growth. The human genome contains several non-transcribed pseudogenes of this gene.[provided by RefSeq, Jun 2013]'
Locus ID 292

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.