MAD2L2 (NM_006341) Human 3' UTR Clone

CAT#: SC204508

3`UTR clone of MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAD2L2
• Synonyms: FANCV; MAD2B; POLZ2; REV7
• ACCN: NM_006341
• Insert Size: 307
• Sequence Data:
  Insert Sequence

  >SC204508 3'UTR clone of NM_006341
  The sequence shown below is from the reference sequence of NM_006341. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAGCTTTACGTGGAAGAGCGCGCTCATAAAGGCAGCTGAGGGGGCACCTGCCACCCCACTGATGCCCAA
  ACTGTCAGACTTTGGGGGATCCCCGCCTAGGGCAGTGCTGCATGGCTGCCCTGATTCCAAGTGCTCTTAT
  CGCCTCTGTGTGTGGATCGCCCGCCCCAGCCCGGGGCCGCTCAGGTCTGCTTGGAGGATGCCTCCCCCAG
  GAGGGCAGTGAGGGATGCCGCAACCTCGACTTCTCAGCCTCCTGGGGTTCCGCCGGCCAACACTGTCTGT
  CTCAAATACTGTGCTGTGAGTTGTTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006341.3
• Summary: The protein encoded by this gene is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. The encoded protein, which is similar to MAD2L1, is capable of interacting with ADAM9, ADAM15, REV1, and REV3 proteins. [provided by RefSeq, Jul 2008]
• Locus ID: 10459