IL7R alpha (IL7R) (NM_002185) Human 3' UTR Clone

CAT#: SC204536

3`UTR clone of interleukin 7 receptor (IL7R) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL7R
• Synonyms: CD127; CDW127; IL-7R-alpha; IL7RA; ILRA
• ACCN: NM_002185
• Insert Size: 362 bp
• Sequence Data:
  Insert Sequence

  >SC204536 3'UTR clone of NM_002185
  The sequence shown below is from the reference sequence of NM_002185. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCACCATGTCCAGCTTCTACCAAAACCAGTGAAGTGTAAGAAACCCAGACTGAACTTACCGTGAGCGAC
  AAAGATGATTTAAAAGGGAAGTCTAGAGTTCCTAGTCTCCCTCACAGCACAGAGAAGACAAAATTAGCAA
  AACCCCACTACACAGTCTGCAAGATTCTGAAACATTGCTTTGACCACTCTTCCTGAGTTCAGTGGCACTC
  AACATGAGTCAAGAGCATCCTGCTTCTACCATGTGGATTTGGTCACAAGGTTTAAGGTGACCCAATGATT
  CAGCTATTTAAAAAAAAAAGAGGAAAGAATGAAAGAGTAAAGGAAATGATTGAGGAGTGAGGAAGGCAGG
  AAGAGAGCATGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002185.2
• Summary: 'The protein encoded by this gene is a receptor for interleukin 7 (IL7). The function of this receptor requires the interleukin 2 receptor, gamma chain (IL2RG), which is a common gamma chain shared by the receptors of various cytokines, including interleukins 2, 4, 7, 9, and 15. This protein has been shown to play a critical role in V(D)J recombination during lymphocyte development. Defects in this gene may be associated with severe combined immunodeficiency (SCID). Alternatively spliced transcript variants have been found. [provided by RefSeq, Dec 2015]'
• Locus ID: 3575