PSME1 (NM_176783) Human 3' UTR Clone

CAT#: SC204544

3`UTR clone of proteasome (prosome macropain) activator subunit 1 (PA28 alpha) (PSME1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSME1
• Synonyms: HEL-S-129m; IFI5111; PA28A; PA28alpha; REGalpha
• ACCN: NM_176783
• Insert Size: 310 bp
• Sequence Data:
  Insert Sequence

  >SC204544 3'UTR clone of NM_176783
  The sequence shown below is from the reference sequence of NM_176783. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCAGGCTAGGGGTTAAGGGTGACAAAGCTCAGCTTCTCCACAAGGCTAGAAATGGGGCACAGAGCCACT
  GGAGGCCTCTGACTGACCTCTACTCCCTGGCCCTGTAGGCTGTGTTATATGACATCATCCTGAAGAACTT
  CGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTGAGAGCCCTCTCTCCCATTCTGT
  GATGAGTACAGCAGAGACCTTCCTGCTTTTTACTGGGGACTCCAGATTTTCCCCAAACTTGCTTCTGTTG
  AGATTTTTCCCTCACCTTGCCTCTCAGGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_176783.1
• Summary: 'The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]'
• Locus ID: 5720