TRIP12 (NM_004238) Human 3' UTR Clone

CAT#: SC204545

3`UTR clone of thyroid hormone receptor interactor 12 (TRIP12) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TRIP12
• Synonyms: MRD49; TRIP-12; ULF
• ACCN: NM_004238
• Insert Size: 353
• Sequence Data:
  Insert Sequence

  >SC204545 3'UTR clone of NM_004238
  The sequence shown below is from the reference sequence of NM_004238. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCAGTCGTTCCATCTTTCCTGATTATAGCAAGAAATGCAGTGTCTGCCTGTTACAGCAAAAGAAACAAA
  TCATGATTTCTTTTCTAATGTTATCACCTGAGTCAAGGAAACATGTTACGCCTTCTTGTTGTAGGAAAAA
  CGGCTTGCAGATTATAAAGAGACATTTGGTTGATATTCATTAATGGCCCCATGGACTTAAAGTGATCAGG
  CCCTAAAACGTTGTTGTGATGAGGTTTCTTTAGCAAGTTCTTGTTTAAATTATCATTTATTTGATGAGTG
  AAGTTTTTAACATGCTTTGCTGTGTGAAATTTAAAAAAGGGATGTTTTTCCAGGCTGGAACAATAAATGT
  GGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004238.1
• Summary: The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
• Locus ID: 9320