LBP (NM_004139) Human 3' UTR Clone

CAT#: SC204559

3`UTR clone of lipopolysaccharide binding protein (LBP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LBP
• Synonyms: BPIFD2
• ACCN: NM_004139
• Insert Size: 369 bp
• Sequence Data:
  Insert Sequence

  >SC204559 3'UTR clone of NM_004139
  The sequence shown below is from the reference sequence of NM_004139. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGACTTCCTGTTCTTGGGTGCCAATGTCCAATACATGAGAGTTTGAGGACAAGAAAGATGAAGCTTGGA
  GGTCACAGCTGGATCTGCTTGTTGCATTTCCAGCTGTGCAGCACGTCTCAGAGATTCTTGAAGAATGAAG
  ACATTTCTGCTCTCAGCTCCGGGGGTGAGGTGTGCCTGGCCTCTGCCTCCACCCTCCTCCTCTTCACCAG
  GTGCATGCATGCCCTCTCTGAGTCTGGACTTTGCTTCCCCTCCAGGAGGGACCACCCTCCCTGACTGGCC
  TGGGATATCTTTACAAGCAGGCACTGTATTTTTTTATTCGCCATCTGATCCCCATGCCTAGCAGAGTGCT
  GGCACTTAGTAGGTCCTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004139.2
• Summary: 'The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]'
• Locus ID: 3929