Ornithine Decarboxylase (ODC1) (NM_002539) Human 3' UTR Clone

CAT#: SC204567

3`UTR clone of ornithine decarboxylase 1 (ODC1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ODC1
• Synonyms: ODC
• ACCN: NM_002539
• Insert Size: 361 bp
• Sequence Data:
  Insert Sequence

  >SC204567 3'UTR clone of NM_002539
  The sequence shown below is from the reference sequence of NM_002539. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAAACGCCACAGAGCAGCCTGTGCTTCGGCTAGTATTAATGTGTAGATAGCACTCTGGTAGCTGTTAAC
  TGCAAGTTTAGCTTGAATTAAGGGATTTGGGGGGACCATGTAACTTAATTACTGCTAGTTTTGAAATGTC
  TTTGTAAGAGTAGGGTCGCCATGATGCAGCCATATGGAAGACTAGGATATGGGTCACACTTATCTGTGTT
  CCTATGGAAACTATTTGAATATTTGTTTTATATGGATTTTTATTCACTCTTCAGACACGCTACTCAAGAG
  TGCCCCTCAGCTGCTGAACAAGCATTTGTAGCTTGTACAATGGCAGAATGGGCCAAAAGCTTAGTGTTGT
  GACCTGTTTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002539.1
• Summary: 'This gene encodes the rate-limiting enzyme of the polyamine biosynthesis pathway which catalyzes ornithine to putrescine. The activity level for the enzyme varies in response to growth-promoting stimuli and exhibits a high turnover rate in comparison to other mammalian proteins. Originally localized to both chromosomes 2 and 7, the gene encoding this enzyme has been determined to be located on 2p25, with a pseudogene located on 7q31-qter. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2013]'
• Locus ID: 4953