PGM3 (NM_015599) Human 3' UTR Clone

CAT#: SC204604

3`UTR clone of phosphoglucomutase 3 (PGM3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PGM3
• Synonyms: AGM1; IMD23; PAGM; PGM 3
• ACCN: NM_015599
• Insert Size: 340 bp
• Sequence Data:
  Insert Sequence

  >SC204604 3'UTR clone of NM_015599
  The sequence shown below is from the reference sequence of NM_015599. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGGAATTGGAGAAAGGCCCCAACCAGGTTTCTGAAGATAATTTTCATATTCCTGAGAAACTGGACTTT
  TTACAAGTCTTTACAAAACTGTCAATAATAATGGCAGTACTAAGAGATTTATAATCATAATGTTTACAAT
  GCAGCCTACTGGATTGTCTCTAGATCTGTTTTTCTTAAACACTAACAGAATAATTCTTTATAAATAGGTA
  AGCCTTACACTTGTTAAAGAAATTTACCTCTAATTTCAGTCTCACTAATGTAAAATACTGGGACTTAAGT
  ATACAATTCAGTCACTAACTGTACAGTTTTATGTGGGGAACAATTCATGCAGGCTACTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_015599.1
• Summary: 'This gene encodes a member of the phosphohexose mutase family. The encoded protein mediates both glycogen formation and utilization by catalyzing the interconversion of glucose-1-phosphate and glucose-6-phosphate. A non-synonymous single nucleotide polymorphism in this gene may play a role in resistance to diabetic nephropathy and neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]'
• Locus ID: 5238