Bone marrow stromal cell antigen 1 (BST1) (NM_004334) Human 3' UTR Clone

CAT#: SC204611

3`UTR clone of bone marrow stromal cell antigen 1 (BST1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BST1
• Synonyms: CD157
• ACCN: NM_004334
• Insert Size: 340 bp
• Sequence Data:
  Insert Sequence

  >SC204611 3'UTR clone of NM_004334
  The sequence shown below is from the reference sequence of NM_004334. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCTTTCTGGTGCTGGCTTCCAGGACTCAACTGTAACTGGAAACTGTGTTGCTCTAACCCTCCTCCAGCC
  CTGCAGCCTCCCCTTGCAGTCATCATTCGTGTTCTGTGTATACCAAATGATTCTGTTATCTAAAGAAGCT
  TTTTGCTGGGAAAACGATGTCCTGAAAATGGTATTTCAATGAGGCATATGTTCAGGATTTCAGAAACAAG
  AAGTTAGTTCTATTTAGCAGGTTAAAAAATGCTGCATTAGAATTAAAGCAAGTTATTTTCTTATTTGTAT
  AATGACACAAAGCATTGGGAGTCAGACTGCTTGTATATTATCAAACATTTTAAGAGAATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004334.2
• Summary: 'Bone marrow stromal cell antigen-1 is a stromal cell line-derived glycosylphosphatidylinositol-anchored molecule that facilitates pre-B-cell growth. The deduced amino acid sequence exhibits 33% similarity with CD38. BST1 expression is enhanced in bone marrow stromal cell lines derived from patients with rheumatoid arthritis. The polyclonal B-cell abnormalities in rheumatoid arthritis may be, at least in part, attributed to BST1 overexpression in the stromal cell population. [provided by RefSeq, Jul 2008]'
• Locus ID: 683