BTD (NM_000060) Human 3' UTR Clone

CAT#: SC204658

3`UTR clone of biotinidase (BTD) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BTD
• Synonyms: biotinidase
• ACCN: NM_000060
• Insert Size: 350 bp
• Sequence Data:
  Insert Sequence

  >SC204658 3'UTR clone of NM_000060
  The sequence shown below is from the reference sequence of NM_000060. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGCTTGTATGAGAGGGACTAGGAAAAGTGTGTGGTCTGTGGGGCGGACTCTGGCCATCATGTTGACAGCC
  TTGCACTTCCACAGGCTACAAGCCCTGGGACCATCTTTCTGCCTTAAGGGCAGGAGCCCACTTCTGTGGC
  ACCAGATTCCACCCTGGGAACTGTGGAAAAAGTAGGAGAGGCAGATTCCCTCAGTGTCTTCCTCTTAAAC
  CTCAATCATCGAGACATTAGGGGGTATTTTCTGTTCACATTTATCTTTTTCAAGCCACATCTTCCTCTAA
  CAAATCTCTCAGTATGCGATTGGTCTCAAGCTAAAACAAAAATAAATGTCAGTTTATATTTTACACATCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000060.2
• Summary: 'The protein encoded by this gene functions to recycle protein-bound biotin by cleaving biocytin (biotin-epsilon-lysine), a normal product of carboxylase degradation, resulting in regeneration of free biotin. The encoded protein has also been shown to have biotinyl transferase activity. Mutations in this gene are associated with biotinidase deficiency. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]'
• Locus ID: 686