PABPC4 (NM_003819) Human 3' UTR Clone

CAT#: SC204691

3`UTR clone of poly(A) binding protein cytoplasmic 4 (inducible form) (PABPC4) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PABPC4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PABPC4
Synonyms APP-1; APP1; iPABP; PABP4
ACCN NM_003819
Insert Size 341
Sequence Data
>SC204691 3'UTR clone of NM_003819
The sequence shown below is from the reference sequence of NM_003819. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGAAGCTGCCCAGAAGGTGGGCGCTGTTGCTGCTGCTACCTCTTAGACAAGGAAAAACCGATTCAAAAG
CCAAATAACCCCTTATGGAATTCAACTCAAGGTTTGAAGACTTCCTAGCTTGTCCTATGGACCTCAACAC
CAAGGATTACAAATTGCAAATTTAATAGGTCATTTTGTATCAAAAGGTCAATTATGAAGCACCTAGAATT
TTTCAATTATACGAATATGTTCTTTGGGTTCTGCTGTGGCCCAGACAGTGTTAACTTTTTTTTTATTGTG
GGTTTTGATTTTTTCCCCCAGAAATTGGTTTTATTTGATGTACCCAAGTCTTACGTTTCCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003819.3
Summary Poly(A)-binding proteins (PABPs) bind to the poly(A) tail present at the 3-prime ends of most eukaryotic mRNAs. PABPC4 or IPABP (inducible PABP) was isolated as an activation-induced T-cell mRNA encoding a protein. Activation of T cells increased PABPC4 mRNA levels in T cells approximately 5-fold. PABPC4 contains 4 RNA-binding domains and proline-rich C terminus. PABPC4 is localized primarily to the cytoplasm. It is suggested that PABPC4 might be necessary for regulation of stability of labile mRNA species in activated T cells. PABPC4 was also identified as an antigen, APP1 (activated-platelet protein-1), expressed on thrombin-activated rabbit platelets. PABPC4 may also be involved in the regulation of protein translation in platelets and megakaryocytes or may participate in the binding or stabilization of polyadenylates in platelet dense granules. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Locus ID 8761

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.