MAG (NM_002361) Human 3' UTR Clone

CAT#: SC204697

3`UTR clone of myelin associated glycoprotein (MAG) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAG
• Synonyms: GMA; S-MAG; SIGLEC-4A; SIGLEC4A; SPG75
• ACCN: NM_002361
• Insert Size: 361 bp
• Sequence Data:
  Insert Sequence

  >SC204697 3'UTR clone of NM_002361
  The sequence shown below is from the reference sequence of NM_002361. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGAGTATGCTGAAATCCGGGTCAAGTGAAGGAGCTGGGGGCAGCCTGCGTGGCTGACCCCCCTCAGGA
  CCCTCGCTGGCCCCCACTGGCTGTGGGCTCCCTTCCTCCCAAAAGTATCGGGGGCTGGGGCAGGAGGGGA
  GTGAGGCAGGTGACAGTGAGGTCCTGGGGGCCTGACCTCCCCCTCCTTCCCAGCTGCCCCTCCCTGCCAG
  CACCCCCACGCCCTCATTACGGCTCCTCTCTAACCTCCTTTACCCTCATCTGTCTGGAGGGGAGCTCTGT
  CTGTCCGTGTTATTTATTGCTACTTCCTGCCTGGTCTCCTGCCCCCACACCTGGCCCTGGGGCCTGTACA
  AAAGGGACATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002361.2
• Summary: 'The protein encoded by this gene is a type I membrane protein and member of the immunoglobulin superfamily. It is thought to be involved in the process of myelination. It is a lectin that binds to sialylated glycoconjugates and mediates certain myelin-neuron cell-cell interactions. Three alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Nov 2010]'
• Locus ID: 4099