DEGS2 (NM_206918) Human 3' UTR Clone

CAT#: SC204711

3`UTR clone of degenerative spermatocyte homolog 2 lipid desaturase (Drosophila) (DEGS2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DEGS2
• Synonyms: C14orf66; DES2; FADS8
• ACCN: NM_206918
• Insert Size: 367
• Sequence Data:
  Insert Sequence

  >SC204711 3'UTR clone of NM_206918
  The sequence shown below is from the reference sequence of NM_206918. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGGCAAAAGATGGTCTGTGAGCCCGGGCTGCCTCCTGGTGGTGGCCATTGTCCCCCATCGGCCCCTCA
  GCCTTGCACCCCAGCACTGAGAAGCTACATTTCCTTCCTGTGCTCTGGACTGCTGCCCTTGTCCCCGAGG
  AGTGTCCCGCGCAGCCACACCTGGCAACAGCAGTGTGGGCTGCAGGGCTCCGTCTGCACGTGGACTTGCC
  CTGGACCTTGAGTGTGGCCCTCCCTTTCTGGGCCTCCCCAGGTGAGGCCTGGCCCTGCCCCACCATGACC
  TGGGTGCTCTGAGCCCACGGTTCCCACGGAGCTGACTTCTCCGGGGTGCCTGTGCCCTACATTAAACCCG
  GCGTTTGTTTCACAGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_206918.2
• Summary: This gene encodes a bifunctional enzyme that is involved in the biosynthesis of phytosphingolipids in human skin and in other phytosphingolipid-containing tissues. This enzyme can act as a sphingolipid delta(4)-desaturase, and also as a sphingolipid C4-hydroxylase. [provided by RefSeq, Oct 2008]
• Locus ID: 123099