RNASEH2B (NM_024570) Human 3' UTR Clone

CAT#: SC204744

3`UTR clone of ribonuclease H2 subunit B (RNASEH2B) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNASEH2B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RNASEH2B
Synonyms AGS2; DLEU8
ACCN NM_024570
Insert Size 307
Sequence Data
>SC204744 3'UTR clone of NM_024570
The sequence shown below is from the reference sequence of NM_024570. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAAAAAAAATTGGAAAGGTTTGAAACTTTGAAAATAAAATCTAGCAAAAATATTTGCTTTTTACATGTTT
CAGTTTGTCCTTCCTGACTGTTAATGACTACCTTTGGTTGGGGGAAGGAAGAGGCCAATTTCATGTTCTC
TTAAACATTTCTTTGCATTTGGTTTTTGTGTTCCTGAACAAAATATGGGAAAGTGTCTAACTTCATGGCT
ATGGCCTTTTGGAGTCTCATCTGACATAATGAAAAGTAATCACTTGAAGAGAATTAACATATAGCATCAT
GATTTTCTCAATAAACTGATGTGTGAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024570.2
Summary RNase H2 is composed of a single catalytic subunit (A) and two non-catalytic subunits (B and C) and specifically degrades the RNA of RNA:DNA hybrids. The protein encoded by this gene is the non-catalytic B subunit of RNase H2, which is thought to play a role in DNA replication. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Aicardi-Goutieres syndrome type 2 (AGS2). [provided by RefSeq, Nov 2008]
Locus ID 79621

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.